+ Reply to Thread
Page 4 of 4 FirstFirst 1 4
Results 61 to 70 of 70

Thread: Messages from Indigo 5 year old

  1. Link to Post #61
    United States Avalon Member PixieDust's Avatar
    Join Date
    15th May 2011
    Location
    Kansas, USA
    Age
    35
    Posts
    231
    Thanks
    747
    Thanked 1,269 times in 212 posts

    Default Re: Messages from Indigo 5 year old

    Quote Posted by Zaya (here)
    Pixie, while I am thinking of it... I just recently purchased this angel tarot card deck for Indigos (Doreen Virtue's Indigo Angle Oracle Cards), and would recommend it to you whole heartedly. You can find it on Amazon here: http://www.amazon.com/Indigo-Angel-O...s=angel+indigo or in Barnes and Noble...

    I do not know if you are into this kind of thing or not. I will say you do not need to have any kind of experience to get good results. I have always been fascinated by tarot but have not really pursued it beyond mild curiosity. Something about this deck though has given me wonderful, simple to understand, intuitive results which are almost undeniable. Perhaps they can help you like that have helped me. I have been using them to attempt overcoming some of my personal roadblocks and feel that they have been helpful so far.
    I actually already own this

  2. The Following 2 Users Say Thank You to PixieDust For This Post:

    Fairy Friend (15th May 2014), Zaya (16th May 2014)

  3. Link to Post #62
    United States Avalon Member PixieDust's Avatar
    Join Date
    15th May 2011
    Location
    Kansas, USA
    Age
    35
    Posts
    231
    Thanks
    747
    Thanked 1,269 times in 212 posts

    Default Re: Messages from Indigo 5 year old

    Quote Posted by Fairy Friend (here)
    Quote Posted by PixieDust (here)
    Quote Posted by Fairy Friend (here)
    I so admit I'm curious about the code myself yet. Are we sure this isn't a base 4 code because the C is sometimes reversed and I know little kids will do that but it may be on purpose. Base 4 like DNA codes or she writing so it could be read both up and down or right and left, like the ancient Egyptians did. They wrote multiple messages in different directions, which is why their texts are all block shaped. Hard to say because I know kids reverse letters. Or they Write upside down just to write upside down for fun.
    Very interesting! I wondered about the C's as well. Her name is Charlie (Charlotte) so that is where the C's are coming from but I didn't know if they were meant to be C's, or if they are unformed zeros or crooked 1's. Your connection to Base 4 DNA codes intrigues me because a lot of thoughts have been floating around about DNA and the new DNA that is being evolved into the human race. Pure speculation.... the code might be something about the new DNA. Thought this is probably me projecting what I hope and I will not know until we find someone skilled in breaking codes. I wrote in perfect mirror image as a child, so thinking beyond Left to Right reading is very plausible. Her twin writes in squares but so far Charlie has been doing well going left to right but that is in a structured space, not when she is being creative.
    Well maybe it is a binary code then and she maybe referring simply too... that it's coming from Charlotte. So could simply be saying it's coming from her. Or it is a base 3 code and that's the direction to read the code.

    As far as DNA codes and all the hoopla I don't relate to that. I'm a Cytogeneticist we have 46 strands of DNA. I have no idea how they relate to chakras which is energy or physics and dimensions. So to me everybody is trying to relate things that maybe shouldn't relate. Or I connect the dots differently maybe is a better way to put that because I do believe those dots all kind of Connect. I learn new things everyday.

    It would just be simpler if kids had instruction manuals. We all know that.
    an instruction manual would be great! lol! Your job must be really cool. I'm not really for testing children, but have you looked at your grandsons DNA? I personally don't think DNA does relate to chakras or energy or dimensions either. Very interesting though.

  4. The Following 2 Users Say Thank You to PixieDust For This Post:

    Fairy Friend (15th May 2014), Tesla_WTC_Solution (16th May 2014)

  5. Link to Post #63
    United States On Sabbatical
    Join Date
    14th October 2013
    Location
    Here I am
    Age
    63
    Posts
    1,324
    Thanks
    5,253
    Thanked 3,602 times in 1,157 posts

    Default Re: Messages from Indigo 5 year old

    Quote Posted by Zaya (here)
    Pixie, while I am thinking of it... I just recently purchased this angel tarot card deck for Indigos (Doreen Virtue's Indigo Angle Oracle Cards), and would recommend it to you whole heartedly. You can find it on Amazon here: http://www.amazon.com/Indigo-Angel-O...s=angel+indigo or in Barnes and Noble...

    I do not know if you are into this kind of thing or not. I will say you do not need to have any kind of experience to get good results. I have always been fascinated by tarot but have not really pursued it beyond mild curiosity. Something about this deck though has given me wonderful, simple to understand, intuitive results which are almost undeniable. Perhaps they can help you like that have helped me. I have been using them to attempt overcoming some of my personal roadblocks and feel that they have been helpful so far.
    I have several of Doreen Virtue decks too. I find them very helpful also. I know something about the tarot as well and the decks are far more positive oriented. Although the tarot is still my favorite I had a very long time.

  6. The Following 3 Users Say Thank You to Fairy Friend For This Post:

    PixieDust (15th May 2014), Tesla_WTC_Solution (16th May 2014), Zaya (16th May 2014)

  7. Link to Post #64
    Unsubscribed
    Join Date
    20th November 2012
    Location
    gone
    Age
    40
    Posts
    4,873
    Thanks
    15,814
    Thanked 18,722 times in 4,284 posts

    Default Re: Messages from Indigo 5 year old

    I get what you're saying Pixiedust -- it's a very empowering philosophy.
    Zaya's post is good too. She gives a better example of my reasoning for saying what I did.
    I am glad your family is healthy.

    In Walla Walla we get orange sky a lot, btw, when the sun sets properly.

    Zaya's tarot idea was wonderful, in fact it was exactly what I was thinking -- weird that we both thought of tarot.

    Once when I was homeless another wandering lady gave me a tarot reading.
    I've only had two done -- one was my spouse and one was from her.

    And they were startlingly accurate/predictive.
    I think of it more like computing than worship etc.


    Paganism is fine -- "Pagan" means "of the people", right?
    So whatever feels natural.
    Some don't agree but witchcraft at is base is the preservation of the wild,
    along with conscious knowledge that comes with being human.


    I'm not practicing (that I know of lol) but am super interested and wouldn't discourage you guys from practicing what you wish.

    We could all use more peace on earth.

    edit: Fairy Friend and I posted at the same time, lol sorry about that

  8. Link to Post #65
    United States On Sabbatical
    Join Date
    14th October 2013
    Location
    Here I am
    Age
    63
    Posts
    1,324
    Thanks
    5,253
    Thanked 3,602 times in 1,157 posts

    Default Re: Messages from Indigo 5 year old

    For fun I had to give it a try and translate this To DNA. I Thought what looks closest. I also thought CG base pairs are more common, I could have gone a different way but a line looks like a T, the C is C, the O is A, and backwards C is G, if I go by what looks like it may match. It could be assigned differently, such as I being G instead of T.....

    DNA: TCTCTCTTCTCTGTCTCTCTCTC....I questioned a break here,? if it was a Y or a dash and C smudged together but since her writing seems different after this point, I thought let's restart here. TCTCTCTCTCTCTCCTTATATATCTCTGTCCTCTGTCTGTGTCTCTCCTCTCTCTCTCGTGTATGTCTATCCTCTGTC. This translates to RNA then to Amino acids.

    Ser.Leu.Phe.Ser.Val.Ser.Leu. 2 unmatched base pairs??? Where I restart...Ser.Leu.Ser.Leu.Leu.Met(also a start code).Tyr.Leu.Cys.Pro.Leu.Ser.Val.Ser.Leu.Ser.Leu.Ser.Cys.Met.Ser.Lle.Ser.Val. This is a small code actually. My interpretation is that The tandem repeat in the beginning looks more like an intron code, so where a protein may bind or a buffer region between translatable codes. Then we have a start code or 2 pop up and that looks more like a start of a code sequence.

    My interpretation so far, I am not surprised to see Leu and Ser coded a lot, they have a lot of redundant codes for those amino acids. Now I will try to see if this is a real protein. Those Methionine codes also are start codes. So I may be able to match it easier if it is the beginning of a code. I am rusty with this part. It may seem long but it really is not that big these usually are huge. There are 20 amino acid and it is questionable that only 8 show up but not hugely, it is such a short sequence. If I misjudge the break point on her picture (I wonder if it is a TC that I missed) Then I get an entirely different sequence. I will later explore a little more to see. I lean toward it NOT being a DNA sequence but not ruling it out yet. It is fascinating.

    Ok did my best to identify this. The first part did not identify any code but the tandem repeat sequence was not species specific but popped up for lots of organisms, mammals, amphibian, psuedomonas, but no real code identified. So it does look like a common noncoding region probably a intron region, telomere or centromere or what everyone seems to call “nonsense DNA” but I don't. I asked for 90% match and got no matches at all for the second part. If we ask to see what a possible protein like this does if it were a protein, we get slightly acidic, slightly ionic and possible ligand that binds to heavy metals but less than 40% and wouldn't commit to a image. Technically, it didn't match any known sequence and I wouldn't be surprised if other variations lead nowhere because there isn't enough variations to translate, it's too repetitive.

    I am thinking this is NOT DNA but I had to see how for it would lead me.

    My grandson's DNA has not been done. Not sure if it is necessary for him, although I would like some things ruled out of course. I cannot do his DNA myself in the USA it is now a HIPPA violation being related. I did my own cytogenetics before that rule existed.

    At the end of the day, this may mean something to your little tiger and her alone. It maybe nothing at all like code but more mathematical or an artistic impression/expression. Noxon Medem said music. FACE are music notes too, in between the lines. It would be interesting to see the notes played if the line is F and O is A and C is C and backwards C an E then what does it play? Did you try that? OK my daughter showed me an app for music and even though it is very repetitive, this sounds better as music.
    I would think about musical instruments for her and her twin. Notes repeating didn't sound to bad to me and would be something a child might like and express music/mathematics this way. I'm surprised, this didn't sound bad at all. It reminds me of a horse galloping or a bee buzzing around. I do not know how to download this music.

  9. The Following 3 Users Say Thank You to Fairy Friend For This Post:

    Atlas (18th May 2014), PixieDust (17th May 2014), Sunny-side-up (10th June 2014)

  10. Link to Post #66
    Avalon Member T Smith's Avatar
    Join Date
    15th January 2011
    Posts
    1,785
    Thanks
    15,307
    Thanked 11,418 times in 1,676 posts

    Default Re: Messages from Indigo 5 year old

    Hello PixieDust,

    Simply amazing. Please keep us posted on the drawings and anecdotes. And she sounds like she couldn't have a better and more encouraging mother!

    Some things that come to mind reading through the thread:

    I've spend a lot of time studying and analyzing the eugenics campaign currently afoot. It is an extremely complicated and complex issue, and also a sensitive one, as none of us have all the answers about why the controlling powers are waging this war against us. The objectives, intentions, means, and methods are in debate, but at the end of the day there can be no question a war is currently afoot against the physiology of all living thing, and not just against us humans. There is also a psychological war being waged against all our minds; developing minds of children are especially vulnerable. I agree with the home schooling ideas discussed earlier in the thread--if you can swing it. I believe there are also home-school support groups you might find helpful if you decide to go that route.

    While surely an over simplified explanation, the attack unfolding on our planet right now against us humans may be one of the reasons souls like your daughter are incarnating here in the first place. I've long suspected (to share my personal thoughts about the why of it all) that the onslaught of chemicals, e.g. fluoride, BPA, heavy metals, etc., etc., (and some to which we may not even be privy) may be in part to dull the heightened abilities and awareness, perhaps even the enhanced DNA of all Indigos, Crystals, Rainbows coming into the world to assist our species with this problem.

    I don't know where you stand on this issue, and please forgive me if I'm coming off as pious in any way. I wouldn't presume to proffer any advice about how to navigate the waters of this war... I just thought I would throw out some of my thoughts as I read through the thread. I'm sure you have already considered all these predatory machinations and have come to your own conclusions. In my estimation is very likely, if not certain, that vaccines, plastics, processed foods, and public drinking water are all deliberate weapons of this war. We parents are continually subject to difficult choices!

    I love the thread and hope you will continue to share all of your and your daughter's adventures with us!

    Warm Regards,
    T Smith
    Last edited by T Smith; 17th May 2014 at 14:21.

  11. The Following 6 Users Say Thank You to T Smith For This Post:

    doodah (25th June 2014), EsmaEverheart (18th May 2014), Fairy Friend (17th May 2014), PixieDust (17th May 2014), Sierra (19th May 2014), Zaya (17th May 2014)

  12. Link to Post #67
    United States Avalon Member
    Join Date
    24th June 2013
    Language
    English
    Posts
    1,984
    Thanks
    2,726
    Thanked 6,947 times in 1,689 posts

    Default Re: Messages from Indigo 5 year old

    You must encourage her in every possible way to talk about her other home and its family, the other world and its technology, schools, ideas, everything. When you sit alone, say "Tell me again about so and so." Just listen. After she is quite finished, you may ask a curious question and then let her answer. Never give her YOUR conclusions or ideas about what she has said. Keep these revelations as pictures in your mind so that you will not forget them. You may learn about her home in another universe. Amor

  13. The Following 5 Users Say Thank You to amor For This Post:

    Fairy Friend (30th May 2014), PixieDust (15th June 2014), Selene (30th May 2014), Sunny-side-up (10th June 2014), Zaya (30th May 2014)

  14. Link to Post #68
    Australia Avalon Member Anchor's Avatar
    Join Date
    10th February 2010
    Location
    NSW, Australia
    Language
    English
    Age
    60
    Posts
    4,601
    Thanks
    11,212
    Thanked 25,835 times in 3,731 posts

    Default Re: Messages from Indigo 5 year old

    I don't think it is ternary. There are more than three symbols being used noting the backward C and C as distinct and assuming not due to errors.
    -- Let the truth be known by all, let the truth be known by all, let the truth be known by all --

  15. The Following 2 Users Say Thank You to Anchor For This Post:

    Fairy Friend (10th June 2014), Sunny-side-up (10th June 2014)

  16. Link to Post #69
    Taiwan Unsubscribed
    Join Date
    17th January 2014
    Location
    Asia, mostly H.K.
    Posts
    688
    Thanks
    321
    Thanked 1,816 times in 505 posts

    Default Re: Messages from Indigo 5 year old

    Great, Pix.

    You daughter is not alone.

    Have you heard / seen this?

    Webre interviews Mary Rodwell

    32:30
    AW: What is the next step Homo Novis? What is that like?.....

    MR: What Lee told me about Homo Novis is there is this huge shift then in terms of our awareness.
    She believes that there are a number of Homo Novis already on the planet
    And I said, "Do you have any sense of how many?"
    She said, "In fact, there are about 150,000 who are Homo Novis that have come to help with the Shift."
    .......
    Some of them look absolutely human but they all report on what's going on and are in all levels of society.
    So we've got a lot going on.

    AW: So the Homo Novis that are here are technically us?
    Or are they technically ETs?
    Or are they something new?

    MR: All she said is that they have come to this planet with the awareness of a Homo Novis
    They're an upgrade

    AW: ..... What would define a Homo Novis consciousness?

    MR: ......It's where we manifest
    We get to a point where we can literally manifest
    The way we look at avatars being able to do incredible things ... this is where we will be
    .....It's almost like we would choose whether or not we would have form

    AW:... The old prophesy: Even as I do so you shall be able to do
    Something like that? Kind of avatar

    MR: There are still other levels above that


    AW asks about the Shift



    41:05
    MR: The dates that seem to be coming up for something dramatic is between ....2012 up to 2017 is the crucial time
    More likely sooner rather than later, there is going to be something very profound
    Almost like we can't even imagine what this will be
    Certainly there does seem to be earth changes - that seems to be a given
    But also with that, it's not like it's just earth changes that is going to be the end in any way, but it's going to be dramatic enough to change a great deal of what we have, the way our world is orchestrated from a socio-economic kind of status
    It's going to change through some of these earth changes but also because of this shift in human consciousness
    The waking up, the awakening -
    This seems to be really interesting when so many hundreds of my clients say, "I've got a job to do but I don't know what it is.
    And I'm getting anxious and I feel like I got to know now because it's any time. I got to be aware."
    I hear it so many times ....
    I think it all knows where it's going and it's not going to let you miss the bus
    I think it's about timing and trusting that when it's time, you will know what you need to do.
    It's there and it's almost like to know too soon, would be disabling in the sense that this is going to be so big and so huge that if we had an insight to it, it would put us in a place where we would be paralysed and no longer feeding the kids
    We'll only know it when it happens because it's the only way it can happen that way
    The sense of impending change, huge change and 'I've got something to do. I know it's important but I don't know what it is yet.' is OK to sit with that.
    It's something we'll just have to trust - that the soul knows exactly what it's doing and will let us know when it's time
    .......
    I believe it's humanity. I believe we all are being challenged to grow and to change
    Some of us will open to it and some of us won't
    And that ... is a choice
    One scientist I'm working with call it low frequency people and high frequency people
    We can choose to be a high frequency person or a low frequency and she said that will even be with our diet
    What we choose to eat which raises our frequency or what we choose to explore
    So there's a choice in that
    ..... some people say there will be 2 earths
    Possibly - I don't know
    2 earths: there might be for those who choose to stay in a 3rd density and those who choose to move to a higher dimensional frequency with a different kind of experience
    I don't know ......
    Or it's possible like the 100th monkey
    When 10% or 50% of the planet gets it, everybody does and people wake up
    I've often looked on that in terms of we only use 5%/10% of our DNA.
    The rest is switched off
    Maybe this is when it gets switched on and all the downloads and compressed files the children and adults are getting, these scripts with these languages and software for the new reality for the new switched on hard drive; the new human
    I don't know

    AW: ..... Why are we so important to the ETs?

    MR: Because we are part of them
    We're their children
    ..... They go to other dimensions, other galaxies, other universes and they seed up planets and they are forever doing this
    They take their seeds of life to many different types of environments.
    They even mentioned artificial planets, different forms
    I think it's part of us learning to grow and experience as a soul but also as connected to the family; the galactic universal family
    It's part of this whole matrix of experience and that's why we're important
    It's because they are learning from us and we're learning from them
    It is always a co-operative soul exchange and because in the end, we're all the same
    We come from the same source

    ==
    > source: http://exopolitics.blogs.com/exopoli...formation.html

  17. Link to Post #70
    Avalon Member Flash's Avatar
    Join Date
    26th December 2010
    Location
    Montreal
    Posts
    9,638
    Thanks
    38,028
    Thanked 53,705 times in 8,941 posts

    Default Re: Messages from Indigo 5 year old

    Quote Posted by Ellisa (here)
    That is a lovely picture your daughter drew. Don't push too hard, don't ask for an explanation, there may not be one! Allow her to write and draw as much as she wants, and casually discuss the results with her. She may be practising writing letters, as she sees them, or she may indeed be using a code. She is obviously a bright child, and I find it interesting she is a twin. Is she the dominant twin? You remarked you thought it was an attempt to write down 'twin speech', and indeed it may be. The fact this little girl seems to understand the relationship between speech and writing to depict sounds is unusual, and her drawing is very advanced. You will have fun watching her development as she explores the world. With such a lively mind it is possible she will lead you into areas you never thought existed. Enjoy every moment of her childhood--- it really does not last long enough!!
    My daughter would write similar things at 3-4 telling me she was writing, but she also had a speech impediment (could relate to twin speech of yours) therefore wanting to express herself by any mean possible other than speaking.

    If I had an advice, it would have been to never ever mention it in an open forum. But since it is now in the open, pleaaaaaase be an ever present mom, it is the incredible mom's love that is constant who does get the children out of nefarious hands, consciously but most of the time unconsciously and corrects whatever is done - most of the nefarious work is done psychically by the way but some physically as well. And believe me, all special kids are targetted.

    This is my advice to all parents, get the children out of forums and public places on the web, including Facebook.
    Last edited by Flash; 10th June 2014 at 12:15.

  18. The Following 6 Users Say Thank You to Flash For This Post:

    Anchor (10th June 2014), Fairy Friend (11th June 2014), Hervé (10th June 2014), Mercedes (12th June 2014), PixieDust (15th June 2014), PurpleLama (10th June 2014)

+ Reply to Thread
Page 4 of 4 FirstFirst 1 4

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts